Экспрессия гена протимозина а человека в клетках Е.соli тема автореферата и диссертации по химии, 02.00.10 ВАК РФ

Ляхов, Илья Геннадиевич АВТОР
кандидат химических наук УЧЕНАЯ СТЕПЕНЬ
Москва МЕСТО ЗАЩИТЫ
1997 ГОД ЗАЩИТЫ
   
02.00.10 КОД ВАК РФ
Автореферат по химии на тему «Экспрессия гена протимозина а человека в клетках Е.соli»
 
Автореферат диссертации на тему "Экспрессия гена протимозина а человека в клетках Е.соli"

МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М. В. Ломоносова

ХИМИЧЕСКИМ ФАКУЛЬТЕТ

Ч Ц иг;

На правах рукописи УДК 547.963.32

ЛЯХОВ Илья Геннадиевич

Экспрессия гена протнмозина а человека в клетках Е.соИ

02.00.10 - биоорганическая химия, химия природных и физиологически активных веществ

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата химических наук

Москва -1997

Работа выполнена на кафедре химии природных соединений химического факультета МГУ им. Ломоносова.

Научный руководитель: доктор химических наук

Вартапетян А. Б.

Официальные оппоненты:

доктор химических наук Крынецкий Е. Ю.

кандидат биологических наук Лунин В.Г.

Ведущая организация:

Государственный научно-технический центр: Государственный НИИ генетики и селекции промышленных микроорганизмов.

Защита состоится 23 декабря 1997 года в 17 часов на заседании диссертационного совета Д 053.05.47 по химическим наукам при Московском государственном университете им. М.В. Ломоносова по адресу: 119899, Москва, Воробьевы горы, Институт физико-химической биологии им. А.Н. Белозерского МГУ, аудитория 501.

С диссертацией можно ознакомиться в библиотеке химического факультета МГУ.

Автореферат разослан 20 ноября 1997 г.

Ученый секретарь Диссертационного совета, кандидат химических наук - /

Смирнова И. Г.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Протимозин а - это низкомолекулярный, чрезвычайно кислый ядерный белок, обнаруженный в клетках млекопитающих. Он вовлечен в процессы клеточного деления и является жизненно важным белком. Однако конкретная функция протимозина а и механизм его действия неизвестны, хотя высокая консервативность ч его участие в пролиферации клеток свидетельствуют о том, что протимозин а играет некую фундаментальную роль в живых клетках. Изучение свойств протимозина а в клетках млекопитающих затруднено ввиду сложности организации этих клеток. Поэтому использование простых модельных систем, таких как клетки бактерий, продуцирующих белок млекопитающих, является одним из подходов для понимания свойств белка и механизмов его функционирования.

Цель работы. Целью диссертационной работы является изучение свойств протимозина а при продукции белка в клетках E.coli - модельной системе, для которой существует большое количество хорошо разработанных молекулярно-биологнчес:<их и генетических методов исследования.

Научная новизна и практическая ценность работы. В настоящей работе показано, что при экспрессии гена протимозина а млекопитающих в клетках E.coli происходит остановка деления клеток. За угнетение клеточного роста отвечает мРНК протимозина а, а точнее - ее фрагмент 230-271 и.о., а не сам белок. При исследовании образования ковалентного комплекса протимозина а крысы с тРНК показано, что при продукции протимозина а в клетках E.coli тРНК присоединяется к С-концевой области белка. Комплекс с тРНК может образовывать и С-концевой пептид протимозина а, при этом ни один из С-концевых остатков треонина не принимает участия в образовании связи с тРНК. Также было показано, что протимозин а способен

присоединять тРНК in vitro при инкубации очищенного белка и суммарной РНК E.coli. Реакция протекает наиболее эффективно в присутствии ионов цинка. Протимозин а также способен образовывать комплекс с Т7-транскриптом тРНКЛ1а человека, однако этот процесс малоэффективен. В настоящей работе обнаружено, что протимозин а является цинк-связывающим бел ком, и ионы цинка стимулируют взаимодействие протимозина а с белком Rev ВИЧ-1.

Публикации и апробация работы. По теме диссертации опубликовано пять печатных работ. Результаты исследований доложены на III Всероссийской планово-отчетной конференции по направлению «ГЕННАЯ И КЛЕТОЧНАЯ ИНЖЕНЕРИЯ» (Пущино, 1993), на II съезде биохимического общества РАН (Москва, 1997) и на 13-м Французско-Российском симпозиуме «Структура и регуляция эукариотических генов» (Монпелье, 1997).

Структура и объем диссертации. Диссертация изложена на 145 страницах машинописного текста и состоит из следующих частей: введение, обзор литературы, результаты и обсуждение, материалы и методы, выводы, список цитируемой литературы. Работа проиллюстрирована 48 рисунками и 28 таблицами.

СОДЕРЖАНИЕ РАБОТЫ

1. Подавление деления клеток E.coli при продукции протимозина а человека и возникновенне резистентности.

Ранее было обнаружено, что при продукции протимозина а человека (пТЧ) в клетках E.coli наблюдается подавление клеточного роста. Выяснение возможных механизмов этого явления было одной из задач настоящей работы.

Для изучения влияния пТ на клетки E.coli была сконструирована плазмида рКР15, производная вектора рКК223-3,

содержащая кДНК пТЧ под контролем IPTG-зависимого tac-промотора и позволяющая продуцировать пТЧ в клетках E.coli. Культуры клеток E.coli штамма JM109, несущих плазмиду рКР15 или вектор рКК223-3, выращивали в присутствии индуктора транскрипции IPTG и без него. При измерении оптической плотности культур было обнаружено, что клетки, содержащие вектор рКК223-3, как в присутствии индуктора IPTG, так и без него, а также клетки, содержащие плазмиду рКР15, без IPTG растут с одинаковой скоростью. Однако при добавлении индуктора клетки, содержащие плазмиду рКР15, не делятся в течение приблизительно 11 часов, после чего начинают расти (Рисунок 1). Если индуктор добавлять к культуре клеток, содержащих плазмиду рКР15, не в начальный момент времени, а через 4 часа после посева культуры, то рост клеток сразу же прекращается и возобновляется только через 6 часов.

Рисунок 1. Кинетика роста клеток Е.соИ, несущих плазмиды рКР15 или рКК223-3, в присутствии индуктора и без него.

Было обнаружено, что детектируемые количества пТЧ образуются лишь на поздних стадиях роста культур (участки 3, 4). Таким образом, либо для остановки клеточного роста (участок 2) достаточно небольшого количества белка, либо причина заключается не в самом пТЧ. Выяснилось также, что возобновление клеточного роста

после индукции объясняется отбором мутантных клеток, устойчивых к действию индуктора (фенотип IPTG1).

Можно представить себе несколько типов мутаций, обеспечивающих устойчивость клеток к индуктору IPTG: 1) мутации в области плазмидного tac-промотора, приводящие к уменьшению эффективности инициации транскрипции; 2) плазмидные мутации, уменьшающие копийность плазмиды рКР15; 3) мутации в кДНК пТЧ; 4) мутации в гене lac - репрессора (lacls), препятствующие связыванию индуктора IPTG и, таким образом, блокирующие IPTG- зависимые промоторы, в том числе промотор гена пТЧ на плазмиде рКР15; и т.д. Для упрощения идентификации мутации IPTGr был использован штамм HB 101, имеющий гены lacZ и lacl и несущий плазмиды рКР15 и pREP4 (содержит транскрибируемый ген lacl), который мы назвали HKR. Для локализации мутаций, обеспечивающих IPTG-резистентность, 107 клеток HKR высевали на чашку с агаром, содержащим IPTG и X-GAL. Выросло 5 белых (HKR-w) и 5 голубых (HKR-b) IPTG-резистентных клонов, которые исследовали на наличие мутаций в плазмидах рКР15 и pREP4. Для этого из клонов HKR-w и HKR-b выделяли суммарный препарат плазмиды, которым трансформировали клетки HB 101 и JM109. Полученные клоны проверяли на фенотип Lac по окрашиванию в присутствии X-GAL и IPTG, а также на фенотип LPTGr по способности к росту в присутствии IPTG (Таблица 1).

Таблица 1. Проверка фенотипов Lac и !PTGr клонов HKR-w и HKR-b.

источник плазмиды HKR-w HKR-b

штамм-рецепиепт HBI0I JM109 HB101 JM109

название полученных плазмид pREP4-w pKPI5-w pREP4-b pKP15-b

фенотип 50% Lac* 50% Lac 100% IPTGS 100% Lac" 10% IPTG5 90% IPTGr

Из полученных данных следует: 1. Клетки HKR-w содержат немутангнута плазмиду рКР15 и смешанную популяцию плазмид: pREP4-lacl (дикий тип) и, вероятно, pREP4-lacIs (мутация, приводящая к фенотипу Lac"). Фенотип IPTGr обеспечивается за счет плазмиды pREP4-lacls (ген lacls доминантен). 2. Клетки HKR-b содержат немутантную

плазмиду pREP4 и смешанную популяцию плазмид рКР15: 10% немутантных и 90% устойчивых к индукции rPTG.

Эти результаты были дополнительно подтверждены последовательной трансформацией клеток НВ101 плазмидами pREP4 (lacl* или lacl) и рКР15 (IPTG5 или IPTGr) с последующим анализом полученных клонов на фенотип Lac и IPTGr. Таким образом, существуют два типа мутаций, приводящих к фенотипу IPTG': pREP4-IacIs и pKP15-IPTGr. Каждая из них приводит к уменьшению продукции пТЧ, и любой из них достаточно для фенотипа IPTGr. Мутация lacls делает невозможной дерепрессию промотора гена пТЧ на плазмиде рКР15, определение же характера мутации pKP15-IPTGr потребовало отдельного исследования. Для локализации мутации в плазмиде pKP15-IPTGr были созданы две плазмиды - производные pKP15-IPTGr, в которых либо кДНК пТЧ, либо вся остальная часть плазмиды были заменены аналогичными фрагментами плазмиды рКР15, т.е. заведомо не несущими мутаций. Выяснилось, что в плазмиде pKP15-IPTGr за устойчивость к индуктору IPTG отвечает мутация в векторе, а не в кДНК пТЧ. Вероятнее всего, это мутация в tac-промоторе гена пТЧ, приводящая к уменьшению концентрации мРНК пТЧ и самого белка в клетке.

Мы попытались ответить на вопрос, почему бактериальные клетки, продуцируя пТЧ, прекращают делиться, экспрессируя гены пТ из различных организмов под контролем разных по силе промоторов и в условиях различной эффективности продукции белка. Для этого, помимо плазмиды рКР15, были сконструированы плазмиды рКРЗ и рСР1. При этом исследовались: а) способность клеток E.coli, содержащих плазмиды рКР15, рКРЗ и рСР1, к делению в условиях индукции транскрипции с промотора гена пТ; б) уровень синтеза мРНК пТ методом РНК-блот-гибридизации (зонд - 32Р-меченная кДНК пТЧ), и в) уровень продукции белка. Результаты приведены в таблице 2.

Таблица 2. Способность клеток, продуцирующих пТ, к делению в условиях индукции транскрипции гена пТ.___

Название плазмиды рКР15 рКРЗ рСР1

Источник гена пТ человек крыса крыса

Промотор гена пТ Р«с Ргзс Р,

Способ индукции транскрипции 1РТС 1РТО 42"С

Индукция транскрипции гена пТ + - + - + -

Подавление роста клеток + - + - - -

Количество пТЧ (нг) 50 0 2000 200 400 0

Относительное количество мРНК пТ 10 2 10 2 4 0

№ колонки в таблице 1 2 3 4 5 6

* Плазмиды рКРЗ и рСР1 позволяют продуцировать пТК с довеском на С-конце шести гистидиновых остатков для выделения пТК при помощи аффинной хроматографии на №-ЫТА-агарозе.

Наиболее существенным результатом этой серии экспериментов оказалось то, что продукция почти 10-кратного избытка пТ в случае плазмиды рСР1 (по сравнению с рКР15) не приводит к подавлению роста клеток (колонки 1 и 5). Поэтому подавление роста клеток, содержащих плазмиду рКР15, в присутствии индуктора 1РТО можно объяснить не действием пТЧ, концентрация которого мала, а, по-видимому, образованием мРНК пТЧ, относительная концентрация которой в клетках равна 10 (колонка 1). Подавление клеточного роста не наблюдается при относительных концентрациях мРНК пТ равных 4 или меньше (колонки 2,4, 5, 6).

Для проверки этого предположения были сконструированы плазмиды рО 1151 и рС)1132, содержащие ген пТЧ под контролем 1РТО - зависимого Т5 промотора, и отличающиеся тем, что в плазмиде р(^1132 нарушен инициаторный кодон гена пТЧ, что делает невозможным продукцию пТЧ. Выяснилось, что ингибирование клеточного роста наблюдается в обоих случаях. Следовательно, рост клеток подавляет мРНК пТ, а не сам белок. Ингибирующей активностью обладает не только полноразмерная мРНК пТЧ. Для определения минимального фрагмента мРНК пТЧ, обладающего ингибирующей активностью, был создан ряд плазмид, содержащих различные фрагменты кДНК пТЧ под контролем Т5-промотора. Выяснилось, что область 230-271 мРНК пТЧ длиной 42 н.о. (плазмида рКРг230-271) достаточна для ингибирующего действия.

Анализ нуклеотидной последовательности этой области РНК выявил наличие второй открытой рамки трасляции, смежной с протимозиновой (Таблица 3). Для того, чтобы выбрать между возможностями подавления клеточного роста посредством самой РНК или белка второй рамки, были сконструированы плазмиды, аналогичные плазмиде рКРг230-271, позволяющие продуцировать в клетках Е.соН различные РНК, каждая из которых содержит область 230-270 или 230-250 мРНК пТЧ с различными мутациями (Таблица 3).

Таблица 3. Плазмиды, используемые для продукции мутантных РНК.

Название плазмиды Нуклеотидные последовательности фрагментов гена пТЧ, содержащихся я плазмилах', и аминокислотные последовательности белков второй рамки Иигибирующая активность в клетках Е.соН ;М109 №

рКРгЗI МКМККЬЗОЬКАЗСО... АтаААСАТСАО<ЗААССТСАСТСАССТАСССССААССССССАС 230 240 250 260 270 полная 1

рКРг81 МКМЯКЬЭг АТСААСАТСАССААССТСАСТТАССТАСССССААССССССАО частичная 2

рКРгЮ1 М К М Я К 1 3 . . . АТСААСАТСАССАЧССТСАСТ частичная 3

рКРг207 М К В. К. К Ь Э . . . АТСААСАССАССААССТСАСТ полная 4

рКГг203 М К п АТЙААаТАСАССААССТаАСТ частичка я 5

рКРг204 г ТАСЛАСЛ<ЗСАСОААССТаАСТ отсутствует 6

Мутации показаны жирным шрифтом. Плазмнда рКРгЗ! отличается от рКРг230-27! оптимизированной областью инициации трансляции белка второй рамки.

Было обнаружено, что рост индуцированных клеток, содержащих плазмнду рКРг31 или рКРг202, подавлен. В остальных случаях наблюдается лишь частичное подавление деления клеток (рКРг81, рКРг201 и рКРг203), или же нормальный рост клеток (рКРг204).

Однозначная интерпретация результатов этой серии экспериментов в пользу ингибирующего действия РНК или пептида затруднена ввиду следующего обстоятельства. С одной стороны, укороченная открытая рамка (строка 2) приводит к ослаблению ингибирующей активности, С другой стороны, нельзя исключить, что эти мутации в РНК сами по себе могут быть причиной уменьшения подавления клеточного роста.

При использовании в качестве клеток-хозяев для плазмид pKPr201 и рКРг203 вместо клеток JM109 UAG-супрессорного штамма СА161 и его несупрессорного аналога СА85 в обоих случаях было обнаружено полное ингибированне роста клеток при индукции транскрипции. Таким образом, в этой более чувствительной системе для подавления деления клеток достаточно синтеза фрагмента мРНК пТЧ 230-250 или дипептида MetLys.

2. Продукция антисмысловой РНК протимозина а в клетках E.col't.

Поскольку оказалось, что мРНК пТЧ обладает биологической активностью в клетках E.coli, представляло интерес выяснить, не будет ли в этой системе обладать похожими свойствами антисмысловая РНК пТЧ.

Для исследования влияния антисмысловой РНК пТЧ на клетки E.coli на основе вектора рКК223-3 была сконструирована плазмида рКР12, аналогичная плазмиде рКР15, но несущая под контролем tac-промотора ген пТЧ в обратной ориентации. Исследование кинетики роста культур клеток E.coli, содержащих плазмиды рКР12, рКР15 или вектор рКК223-3, показали, что продукция антисмысловой РНК пТЧ (плазмида рКР12) не оказывает влияния на клеточный рост. Для сравнения уровня продукции смысловой и антисмысловой РНК пТЧ из культур клеток E.coli, содержащих плазмиды рКР12 и рКР15, выделяли препарат суммарной РНК, который анализировали методом РНК-блот-гибридизации с зондом - меченной 32Р кДНК пТЧ (Рисунок 2).

pKFIS рКР!2

Рисунок 2. РНК-блот-гибридизация препаратов РНК, выделенных из клеток, содержащих плазмиды рКР15 (1) и рКР12(2).

Из полученных результатов видно, что смысловая и антисмысловая РНК пТЧ продуцируются в клетках приблизительно в одинаковых

количествах, но антисмысповая РНК пТЧ имеет длину, меньшую, чем у смысловой РНК (смысловая РНК - расчетной длины) (Рисунок 2). Причиной этого может быть деградация новосингезированной антисмысловой РНК клето чныш РНКазами или преждевременная терминацией транскрипции пена пТЧ, находящегося в обратной ориентации относительно 1ас-промотора. Для того, чтобы выбрать между двумя возможностями, был проведен эксперимент с использованием репортерчой последовательности кД11К вироида карликовости хризантем, встроенной в плазмиды рКР12 и рКР15 ниже последовательности кДНК пТЧ относительно 1ас-гтромотора (плазмиды р8У2 и рАУЗ - производные, соответственно, плазмид рКР15 и рКР12). Сильно структурированная РНК вироида длиной 430 н.о. является одной из наиболее устойчивых РНК, поэтому мы предполагали, что если различие в длинах смыслового и антисмыслового транскригггов гена пТЧ связано с деградацией РНК. то в гибридных пТЧ-вироидных РНК деградации может подвергаться только последовательность РНК пТЧ, а РНК вироида может бьпъ детектирована. В противном случае, если эффект связан с преждевременной терминацией транскрипции антисмысловой РНК пТЧ, то РНК-полимераза не будет доходить до участка ДНК, кодирующего РНК вироида, и вироидная РНК будет отсутствовать в клетке.

При исследовании смысловой и антисмысловой РНК пТЧ в клетках Е.соИ, содержащих плазмиды р8У2 и рАУЗ, методом РНК-блот-гибридизации (в качестве зонда для гибридизации использовали меченную НР кДНК пТЧ или кДНК вироида) было обнаружено, что длина транскрипта, содержащего антисмысловую последовательность РНК пТЧ, меньше длины транскрипта, содержащего смысловую последовательность (протимозиновый зонд), в то время как при гибридизации с вироидным зондом сигнал наблюдается только в препарате смысловой РНК (Рисунок 3). Этот результат означает, что уменьшение длины антисмыслового транскрипта (по сравнению со смысловым) объясняется преждевременной терминацией транскрипции.

Рисунок 3. РНК-блот-гибридизация препаратов РНК, выделенных из клеток, содержащих плазмиды рАУЗ (1, 3) или р5У2(2, 4). В качестве зонда для гибридизации использовали меченную ИР кДНК пТЧ (1, 2) и кДНК вироида (3,4).

3. Получение ковалентного комплекса тРНК-протнмозин а при продукции белка в клетках Е.соИ.

Ковалентный комплекс пТ с РНК был выделен в нашей лаборатории из клеток мыши, и образование комплекса пТ-тРНК также было моделировано в клетках Е.соИ, продуцирующих пТК. Для этого использовалась плазмида рС^ЫЗ, содержащая кДНК пТК с блоком из шести гистидиновых остатков на С-конце белка, что позволяет выделять рекомбинантный белок в чистом виде методом аффинной хроматографии на №-КГА-агарозе. Из клеток Е.соИ, содержащих плазмиду рС>№, было выделено соединение, состоящее из пТК и тРНК (преимущественно тРНКЬу5). Было показано, что тРНК присоединена к пТК 5 -концом. В настоящей работе предстояло получить ответы на два вопроса: I) к какому участку в молекуле пТК присоединяется тРНК; 2) является ли способность ковалентно присоединять тРНК свойством самого пТ, или для этой реакции требуются дополнительные факторы?

Для ответа на первый вопрос тРНК в составе комплекса, выделенного из клеток Е.соИ, содержащих плазмиду р<3№, была радиоактивно мечена по 3'-концу. Частичный гидролиз белковой части комплекса 32Р тРНК-пТК трипсином с последующим анализом гидролизата при помощи аффинной хроматографии на №-ЫТА-агарозе и гель-электрофореза выявил наличие двух РНК-пептидов (Рисунок 4).

мрогнякинвовый зонд вироили ы Л юня

рАУЗ р5У2 рАУЗ р5У2

■ 2 3 Ц

Рисунок 4. Продукты неполного гидролиза трипсином комплекса тРНК-пТК. Комплексы тРНК-пептид, связавшиеся (Ч) и не связавшиеся (I) с Ni-NTA-агарозой. III - исходный комплекс тРНК-пТК. Приведен радиоавтограф 8% ПААГ.

тРНК-пептид (I) обладает способностью связываться с Ni-NTA-агарозой (содержит шесть гистидиновых остатков на С-конце пептида), а тРНК-пептид (2) не связывается с Ni-NTA-

агарозой. Пятно 3, по-видимому, является продуктом неспецифического протеолиза комплекса тРНК-пТК - 4, так как оно иногда присутствует и в исходном препарате комплекса (дорожка III). Исходя из полученных результатов, можно сделать предположение, что в комплексе 1 тРНК присоединена к достаточно короткому С-концевому пептиду, а комплекс 2 образуется при более полном гидролизе пТК трипсином. Правильность этого предположения проверяли, исследуя возможность образования комплекса с тРНК при продукции в клетках E.coli пептида, содержащего 26 С-концевых аминокислотных остатка пТК, начиная с 86-го, и тот же гексагистидиновый блок. Для этого была сконструирована плазмида pQC7, направляющая синтез соответствующего пептида, и из клеток E.coli, содержащих плазмиду pQC7, был выделен комплекс РНК-пептид (Рисунок 5).

и* ca<i*eiomii СО СМОЛОЙ —"

• <3-1 тРНК-пТК

>0 « -

30 • ♦

1 II г г г

Рисунок 5. С-концевой пептид пТК способен присоединять тРНК. Подвижность при электрофорезе в 8% ПААГ комплексов тРНК с пТК и с С-концевым пептидом пТК, обработанных трипсином,

протеиназой К и необработанных. Обработки комплекса тРНК-пТК (5-8) и комплекса тРНК-С-концевой пептид пТК (1-4): 2, 6 - обработка комплексов протеиназой К; 1, 5 -комплексы без обработок (б/о); 3, 4, 7, 8 - обработка комплексов трипсином с последующей аффинной хроматографией на N1-ЫТА-агарозе; 3, 7 - не связавшееся с ЫЮТА-агарозой; 4, 8 - элюаты.

Из полученных данных (Рисунок 5) видно, что тРНК может образовывать комплекс не только с полноразмерным пТК, но и с С-концевым пептидом пТК. При частичном гидролизе трипсином обоих комплексов образуются аналогичные комплексы тРНК-пептид (дорожки 3 и 7, 4 и 8). Это подтверждает предположение о локализации места присоединения тРНК к пТК в С-концевой области пТК. Также можно сделать вывод о том, что все активные участки в пТК, необходимые для присоединения тРНК, находятся в С-концевой области пТК.

Во всех известных на сегодняшний день ковалентных комплексах РНК-белок в образовании фосфодиэфирной связи с РНК участвуют остатки оксиаминокислот белка - серина и тирозина Для проверки участия в образовании связи с тРНК трех остатков треонина, расположенных в С-концевой области пТК, были созданы плазмиды, производные плазмиды pQN3, позволяющие продуцировать в клетках E.coli мутантные формы пТК, имеющие точечные аминокислотные замены треонина на аланин: pQN3 (дикий тип), pQT3 (Т86А), pQR3 (TI01 A), pQT8 (TI07A), pQT42 (T86A, T101A, T107A). Было обнаружено, что все исследованные мутантные формы пТК сохраняют способность присоединять тРНК. Таким образом, указанные остатки треонина не важны для образования ковалентного комплекса тРНК-пТК.

iP!!K.ii«itkÍ пТК {87-119) комплекс тРНК-пТК

Т|>МПСМЯ трипсин

иии.т.и.« ^ М1оМ (впашгпе+сй «'о со смалоЛ к """ ce»J»oo;w< íi'o СО СгИЫОЙ

t f

» • • Я • •

1 1 3 4 5 7 8

4. Получение комплекса тРНК-протнмозин a in vitro.

Для исследования условий образования комплекса тРНК-пТК был сделан переход от системы in vivo (продукция пТК в клетках E.coli) к бесклеточной системе in vitro. Мы решили предпринять попытку получения комплекса тРЬГК-пТК in vitro, исходя из суммарной РНК E.coli. очищенного пТК, и, возможно, РНКазы Р -фермента, ответственного за образование зрелого 5'-конца молекул тРНК. Ранее было показано, что в состав комплекса тРНК-пТК, образующегося в клетках E.coli, продуцирующих пТК, входят различные тРНК, и, в частности, тРНК1*". Поэтому для получения препарата суммарной бактериальной тРНК, обогащенной tPHKLvs, на основе вектора рЕТЗЗЬ+ была сконируирована плазмида pKVKIO, содержащая ген предшественника тРНК1''" и тРНКУз) под контролем Т7 промотора. Использование этой плазмиды позволило получить суммарную РНК, содержащую десятикратный избыток tPHKl>s и tPHKv'' по сравнению с бесплазмидным штаммом, в клетках E.coli BL21(DE3), продуцирующих Т7 РНК-полимеразу.

Для получения РНКазы Р E.coli для описанных ниже экспериментов гены белкового и РНК-компонентов этого фермента были амплифицированы из генома E.coli и клонированы. РНК-компонент РНКазы Р был получен путем Т7-транскрипции in vitro. Белковый компонент фермента был выделен из созданного нами штамма-продуцента этого белка при помощи аффинной хроматографии.

Очищенный пТК инкубировали с препаратом немеченной суммарной РНК, выделенной из клеток E.coli BL2I(DE3)/pKVKI0, в присутствии и без РНКазы Р, после чего тРНК в составе комплекса была радиоактивно мечена по 3'-концу. Анализ продуктов реакции методом электрофореза в 8% Г1ААГ показал, что комплекс тРНК-пТК

может быть получен in vitro путем инкубации пТК и препарата суммарной тРНК, и присутствие РНКазы Р в инкубационной смеси не стимулирует образование комплекса (Рисунок 6). Этот результат может означать, что пТК присоединяется к уже зрелой тРНК, либо что пТК, взаимодействуя с предшественником тРНК, не нуждается в дополнительных ферментативных активностях.

Рисунок 6. Комплексы тРНК-пТК, полученные m vitro при инкубации пТК с препаратом суммарной РНК, выделенной из клеток Е.соЧ

BL21(DE3)/pKVK10, в присутствии и без РНКазы Р. 5-8 - препараты комплексов, обработанные (5-8) и необработанные (1-4) протеиназой К.

Было обнаружено также, что РНКаза Р не принимает участия в распаде комплекса тРНК-пТК, по крайней мере, in vitro. Ковалентность связи тРНК-пТК в комплексе подтверждается ее высокой устойчивостью в денатурирующих условиях (Рисунок 7).

Рисунок 7. Устойчивость комплекса тРНК-пТК в денатурирующих условиях. 2 - комплекс тРНК-пТК, инкубированный в течение 5 минут при температуре 100°С в буфере, содержащим 3 М мочевину, 1% ДСН, 10 мМ ЭДТА и 50 мМ Тпз-НС1 рН=8.6; 1 - комплекс тРНК-пТК без обработок.

Результаты подбора буферных условий для эффективного образования ковалентного комплекса тРНК-пТК, исходя из суммарной 32Р-меченной РНК из клеток ВЬ21(ОЕЗ)/рКУКЮ и очищенного пТК, представлены ниже (Рисунок 8).

прогсянюа К

РНКаза Р — _ + - - - + -

пТК — + + + - + + +

РНК + _+ +. JL +. —

£| <|тРНК

1 2 3 4 5 6 7 8

«ЛрвЛогк-« — -f-

грмКГГК ^

Рисунок 8. Комплексы тРНК-пТК, полученные т \'Ьго при инкубации пТК с препаратом тотально меченной 2Р суммарной клеточной РНК.

Составы буферов для инкубации: 1. 50 мМ Тп8-НС1 рН=8.0; II - 50 мМ Тпв-НС! рН=8.0, 10 мМ MgC^, 100 мМ N11,0; III - 50 мМ Тпя-НС! рН=8.0. 10 мМ М§С1>, 100 мМ N4,0. 5 иг/мкл полилтииа: IV - 50 чМ Тг!з-НС1 рН=8.0, 100 мМ МеС13, I М ЫН4С1; V - 50 мМ Тпб-НС! рН=8.0. 200 мМ М§С1,; VI - 50 мМ Тп5-НС1 рН="8 0. 10 чМ МдС13, 100 мМ МН,С1. 50 нг'мкл полилизина.

Препараты комплексов обрабатывали (7-12) и не обрабатывал!! (1-6) прогеиназоП К.

Образование комплекса наиболее эффективно в присутствии ионов магния (V), что наводит на мысль о металлозависимости реакции. Поэтому было исследовано влияние ионов других металлов и рН среды на образование комплекса. Оказалось, что образование комплекса наиболее эффективно в присутствии 10 мМ сульфата цинка, оптимум рН=7.6.

npnrrfoaia К

kO.ill 1ГЫ т tfl ift in

♦ 4111

1ГНКР • - mm

1 2 3 4

Рисунок 9. Электрофоретическая подвижность в 8% ПААГ комплексов тРНК-пТК, полученных in vitro (2) и выделенных из клеток Ecoli, продуцирующих пТК (1). Препараты комплексов обрабатывали (3, 4) и не обрабатывали (1,2) протеиназой К.

Существенным отличием комплекса тРНК-пТК, образующегося in vitro, является его гетерогенность и большая электрофоретическая подвижность по сравнению с комплексом, образующимся при

продукции пТК в клетках E.coli (Рисунок 9). Для того, чтобы понять, чем могут отличаться эти соединения, необходимо было проанализировать их РНК и белковые составляющие. Для определения длины РНК, присоединенной к пТК, индивидуальные комплексы I, II и III, содержащие меченную 32Р РНК, обрабатывали протеиназой К для удаления белкового компонента (Рисунок 10). Из полученных данных видно, что РНК компонент во всех трех комплексах имеет одинаковую длину, совпадающую с длиной тРНК.

Рисунок 10. Подвижность РНК компонента комплексов тРНК-лТК при электрофорезе в 8% ПААГ. 1,2- комплекс П и 3, 4 -комплекс III, полученные in vitro-, 5, 6 - комплекс i, вьделенный из клеток Ecoff, продуцирующих пТК. Препараты комплексов

обрабатывали (2,4,6) и не обрабатывали (1,3,5) протеиназой К.

Для определения электрофоретической подвижности белкового компонента комплекса тРНК-пТК необходимо удалить основную часть последовательности тРНК, оставив один нуклеотид, связанный с белковой частью. Полученный таким образом пТК-нуклеотид должен иметь практически такую же электрофоретическую подвижность, как и свободный белковый компонент комплекса. Ранее в нашей лаборатории было показано, что белковым компонентом комплекса 1 тРНК-пТК является пТК. Из двух комплексов тРНК-пТК, полученных in vitro, только комплекс III удалось получить в тотально меченном 32Р по тРНК варианте с достаточной для проведения эксперимента удельной радиоактивностью. При обработке комплекса III тРНК-пТК смесью РНКаз А и Тт образуется соединение с электрофоретической подвижностью пТК (Рисунок 11). Следовательно, белковой частью комплекса III тРНК-пТК также является пТК. Тот факт, что

шинкп m ÎPÎIK-IITK W> in r w« in tw»

ll|WlritNI1l К — + — + — + V «

тРНК ^ m

I 2 3 4 s «

мононуклеотид (или очень короткий олигонуклеотид), образующийся после гидролиза тРНК-компонента комплекса РНКазами, остается присоединенным к пТК. дополнительно свидетельствует о ковалентной связи между пТК и тРНК.

,PHlC-..rw

■ РНК А-Т3 •»«■•)• К

■ РКК ^ ..ГЦ- >>

Рисунок 11. Подвижность белкового компонента комплекса III тРНК-пТК. 1 -суммарная тотально меченная 32Р тРНК ELcoli-, комплекс III, обработанный смесью РНКаз А и Т3 (2) и протеиназой К (3). Положение в геле немеченного пТК показано стрелкой.

Различные комплексы тРНК-пТК (I и Ш) состоят из одинаковых компонентов, но их электрофоретическая подвижность в ПААГ различается. Можно предположить, что комплекы I и III имеют различную стехиометрию гтТК и тРНК. Этот вопрос, несомненно, заслуживает специального исследования.

Для того, чтобы определить, что является РНК-субстратом для данной реакции: предшественник тРНК, зрелая тРНК с модифицированными основаниями и т.д., в качестве РНК-субстрата была использована тРНКл1а человека, полученная при Т7-транскрипции фрагмента ДНК, содержащего последовательность тРНКА'а под контролем Т7 промотора. пТК и тРНКЛ'а инкубировали в буфере, содержащем 10 мМ ZnSOi, и анализировали стандартным образом. В результате нам удалось детектировать комплекс тРНК-пТК, имеющий электрофоретическую подвижность комплекса III

тРНК-пТК. Однако его количество было мало по сравнению с тем, которое наблюдалось при инкубации пТК с суммарной клеточной РНК. Одной из возможных причин низкого выхода реакции может служить отсутствие в Т7-транскрипте модифицированных оснований, характерных для зрелой тРНК. Тем не менее, этот эксперимент свидетельствует о том, что: 1) пТК способен присоединяться к тРНК в отсутствие дополнительных кофакторов; 2) субстратом для данной реакции может служить полностью процессированная тРНК, не содержащая модифицированных оснований.

Следует отметить, что нам не удалось наблюдать образование комплекса тРНК-пТК при совместной инкубации пТК и предшественника тРНК^ и тРНКУа1.

5. Протимозин а - цинк-связывающий белок.

Тот факт, что образование комплекса тРНК-пТ происходит наиболее эффективно в присутствии ионов цинка, навел нас на мысль, что пТ может быть цинк-связывающим белком. Мы также обратили внимание на то, что цинк-связывающим является кислый белок паратимозин а, который имеет некоторое сходство с пТ.

Для проверки способности пТ связывать ионы металлов была использована аффинная хроматография смеси свободных тРНК и пТЧ на иминодиацетатной смоле СЬе1ех-100, заряженной различными двухвалентными катионами. тРНК использовали в качестве контроля на неспецифическое связывание отрицательно заряженных биополимеров с носителем. Было обнаружено, что только ионы цинка специфически связываются с пТЧ, но не с тРНК (Рисунок 12, дорожки 5 и 10).

исходная смесь пТЧ и тРНК пс спялшшсеся со смолой элюггы

Mg Са Zn Cu Mg Са Zn Cu

фтРНК

«а» ФпТЧ

i 2 3 4 5 6 7 8 9 10 11

Рисунок 12. Результаты аффинной хроматографии смеси пТЧ и тРНК на смоле Chelex-100 в присутствии ионов различных двухвалентных металлов. 1 - смесь пТЧ и тРНК, не прошедшая стадию аффинной хроматографии. Смола Chelex-100, заряженная катионами: 3, 8 - Mg2t; 4, 9 -Са1+; 5,10 - Znu; 6,11 - Cu2*; 2,7 - без двухвалентных катионов.

Описанная выше способность ионов цинка увеличивать эффективность присоединения тРНК к пТК предполагает

функциональную значимость связывания ионов цинка. В качестве еще одного теста на функциональность связывания ионов цинка пТ мы избрали взаимодействие пТ с белком Rev вируса ВИЧ-1.

Для исследования влияния ионов цинка на взаимодействие пТ-Rev был использован радиоактивно меченный 32Р пТЧ (не содержащий гексагистидинового блока), который инкубировали с иммобилизованным на Ni-NTA-агарозе белком (His)6Rev в буфере, содержащем различные концентрации ZnS04: 200, 40 и 0 мкМ. После инкубации смолу промывали буфером того же состава, связавшийся с Rev пТЧ элюировали раствором, содержащим имидазол, и определяли количество меченого 32Р-пТЧ в элюате (Рисунок 13).

Рисунок 13. Ионы цинка стимулируют связывание пТЧ с Rev.

Из результатов эксперимента (Рисунок 13) видно, что ионы цинка в десятки раз стимулируют взаимодействие пТЧ с Rev. В присутствии ионов других металлов - Mg, Са - взаимодействие пТЧ с Rev существенно менее эффективно. Полученные результаты подтверждают потенциальную роль ионов цинка в функционировании пТЧ.

6. Белки E.coli, локально сходные с протимознном а.

пТ является весьма консервативным белком. Уровень гомологии пТ различных млекопитающих составляет более 90%. Работая с пТ млекопитающих в клетках E.coli, нам представлялось интересным выяснить, может ли похожий белок существовать в клетках бактерий.

Для этого мы провели поиск фрагментов ДНК E.coli, нуклеотидная последовательность которых обладает сходством с кДНК пТ. Мы использовали метод ДНК-блот-гибридизации ДНК E.coli штамма JM109, гидролизованной рестриктазами Taql, Mspl и Sau ЗА с 32Р-зондами: кДНК пТЧ и олигонуклеотидом #М, комплементарным области 118-140 кДНК пТЧ (Рисунок 14).

Рисунок 14. Результаты гибридизации рестриктных фрагментов ДНК Ecoti. А -ДНК Ecoti, обработанная рестрикгазами Taq\ (I), КЬр\ (2) и StadA (3). Температура гибридизации и отмывок 50°С; зонд -меченный МР олигонухлеотид #М. Б - ДНК E.coli, обработанная рестриктазой Msp\. Температура гибридизации и отмывок 65°С; зонд - меченная ИР кДНК пТЧ. Стрелками обнозначено положение ДНК-маркеров.

Гибридизующиеся фрагменты ДНК длиной 590 п.н. (Тац\-гидролизат) и длиной 416 п.н. (Мг/Л-гидролизат) клонировали и определяли нуклеотидную последовательность вставок в плазмидах рЕТ7 (7ад1-фрагмент) и рЕТ81 (М/Л-фрагмент). Области сходства каждой из вставок в плазмидах рЕТ7 и рЕТ81 с нуклеотидной последовательностью кДНК пТЧ ограничивались короткими блоками

д Tttqi Л^р I Б

я» 4-МЫ 4 «ДО!

— <(132

4 ¡42

1 2 3 <(211

(блоки #1 и #2 - Таблица 4) длиной 31 и 43 н.о. соответственно.

Другой подход к поиску белков E.coli, сходных с пТЧ, заключается в непосредственном сравнении нукпеотидных последовательностей ДНК E.coli с кДНК пТЧ. Были обнаружены три таких блока, два из которых совпадали с блоками #1 и #2, содержащимися в плазмидах рЕТ7 и рЕ'Г81, и еще один новый блок -#3. Нуклеотидные последовательности и области сходства между блоками tf\, #2 , #3 и кДНК пТЧ, а также между аминокислотной последовательностью пТЧ и продуктами трансляции блоков #1, #2 и #3 приведены в таблицах 4 и 5. Все выявленные блоки являются фрагментами транслируемых частей различных генов. Таблица 4. Области сходства между кДНК пТЧ и блоками tfl, U2 и #3.

120 130 140

AATGAGGAAAATGGGGAGCAGGAGGCTGACA кДНК пТЧ

AATGAGGAAAATGGGGAACTGGAAGCAGACA Елок №\_

150 160 170 180 190 197

ATGACGATGACGAAGAAGAGGAAGAAGACGAGAAGCAAGAAGA Блок #2

ATGAGGTAGACGAAGAAGAGGAAGAAGGTGGGGAGGAAGAGGAGGAGGA кДНК ПТЧ

AGGAAGATCTGGACGATGACGAAGATGA Блок »3

Таблица 5. Области сходства между пТЧ и продуктами трансляции блоков #1. #2 и #3._

40 50 60 70 79

Блок 12 ОООЕЕЕЕЕ—0ЕК0Е

МШ-ЮЕОЕАОНЕУОЕЕЕЕЕССЕЕЕЕЕЕЕЕСО^ЕЕЕОСОЕЭ пТЧ

ИЕЕЫСЕЬЕАО ЕОЬ0В0Е0ЕОЕЕГХ;ООО

Блек >1_Блок ИЗ_

Знаком к*» помечены совпадения идентичных, а знаком «:»- похожих аминокислотных остатков.

Таким образом, непрерывной последовательности ДНК E.coli, гомологичной кДНК пТЧ, обнаружено не было. Возможным объяснением существования аминокислотных последовательностей бактериальных белков, сходных с аминокислотной последовательностью пТ (3 коротких блока локального сходства), может служить наличие в пТ и в указанных белках общих функциональных доменов.

1. При экспрессии гена пТЧ в клетках E.coli происходит остановка роста клеток. За угнетение клеточного роста отвечает мРНК пТЧ, а точнее - ее фрагмент 230-271 и.о., а не сам белок пТЧ. Ингибирующей активностью может обладать либо непосредственно сама РНК, либо этот эффект опосредован синтезом короткого пептида в смежной с пТЧ рамке трансляции. При синтезе в клетках E.coli антисмысловой РНК пТЧ происходит преждевременная терминация транскрипции.

2. В ковалентном комплексе тРНК-пТК тРНК присоединена вблизи С-конца белка. С-концевой фрагмент пТК (аминокислотные остатки 86-111) также способен присоединять тРНК. Остатки треонина, расположенные в этом районе, не принимают участия в образовании связи с тРНК.

3. пТК способен присоединять тРНК in vitro при инкубации очищенного пТК и суммарной РНК, выделенной из клеток E.coli. Реакция протекает наиболее эффективно в присутствии ионов цинка. РНКаза Р не принимает участия в образовании и распаде комплекса тРНК-пТК. пТК способен присоединять синтетический Т7-транскрипт тРНКА|а человека, хотя этот процесс малоэффективен.

4. пТЧ является цинк-связывающим белком. Ионы цинка стимулируют взаимодействие пТЧ с белком Rev ВИЧ-1.

5. В геноме Е. coli обнаружены области локального сходства с кДНК пТЧ.

Основные результаты диссертации изложены в следующих работах:

1. Vartapetian A., Chichkova N., Lyakhov I., Makarova Т., Evstafíeva А., and Bogdanov A. (1992) Segments of Escherichia coli genome similar to the exons of human prothymosin a gene. FEBS Lett. 313, 95-97.

2. Богданов A.A., Вартапетян А.Б., Евстафьева А.Г., Ляхов И.Г., Макарова Т.Н., Чичкова Н.В. (1992) Клонирование и экспрессия гена

эволюционко консервативного иммуностимулирующего белка протимозина а и изучение функций этого белка. Тезисы докладов III Всероссийской планово-отчетной конференции по направлению "ГЕННАЯ И КЛЕТОЧНАЯ ИНЖЕНЕРИЯ", Пущино, 120.

3. Богданов A.A., Варгапетян А.Б., Лукашев Д.Е., Ляхов И.Г., Макарова Т.Н., Чичкова Н.В. (1994) Клонирование и экспрессия бактериального гена эволюциошга консервативного иммуностимулирующего белка протимозина а и изучение функций этого белка. Мол. генет. микробиол. вирусол., 4, 31.

4. Лукашев Д.Е., Ляхов И.Г., Беляева H.A., Карапетян Р.Н., Чичкова

Н.В., Вартапетян А.Б. (1997) Протимозин а ковалентно присоединяется к тРНК. Тезисы докладов второго съезда

биохимического общества РАН, Москва, 122.

5. Vartapetian A., Lukashev D., Lyakhov I., Belyaeva A., Chichkova N., and Bogdanov A. (1997) Mammalian prothymosin a links to tRNA in Escherichia coli cells. RNA 3, 1 173-1181.